Skip to main content
Addgene

pEGFP-GIT1
(Plasmid #15226)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 15226 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PEGFP-C1
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    G protein coupled receptor kinase-interacting protein 1
  • Alt name
    GIT1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2300
  • Mutation
    L425V, E476K and L583P
  • Entrez Gene
    GIT1 (a.k.a. p95-APP1)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sac1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer EGFP-C sequencing primer
  • 3′ sequencing primer TTATAAGCTGCAATAAACAAGTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-GIT1 was a gift from Rick Horwitz (Addgene plasmid # 15226 ; http://n2t.net/addgene:15226 ; RRID:Addgene_15226)
  • For your References section:

    GIT1 functions in a motile, multi-molecular signaling complex that regulates protrusive activity and cell migration. Manabe R, Kovalenko M, Webb DJ, Horwitz AR. J Cell Sci. 2002 Apr 1. 115(Pt 7):1497-510. PubMed 11896197

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More