pSH1/Sn-E-Fv'Fvls-E
              
              
                (Plasmid
                
                #15274)
              
            
            
            
          - 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 15274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepSH1
- 
              Backbone manufacturerGR Crabtree lab
- Backbone size w/o insert (bp) 3500
- 
              Vector typeMammalian Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameFKBP12(V36)
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)750
- 
                  MutationFKBP12 F36V
- 
                        Entrez GeneFKBP1A (a.k.a. FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE)
- 
    
        Tags
        / Fusion Proteins
    - HA epitope (C terminal on insert)
- HA epitope (N terminal on insert)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI, SacII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gaggtgttacttctgctctaaaagc
- 3′ sequencing primer cactgcattctagttgtggtttg (Common Sequencing Primers)
Resource Information
- 
            Article Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pSH1/Sn-E-Fv'Fvls-E was a gift from David Spencer (Addgene plasmid # 15274 ; http://n2t.net/addgene:15274 ; RRID:Addgene_15274)
- 
                For your References section: Improved artificial death switches based on caspases and FADD. Fan L, Freeman KW, Khan T, Pham E, Spencer DM. Hum Gene Ther. 1999 Sep 20. 10(14):2273-85. 10.1089/10430349950016924 PubMed 10515447
 
    
 
                         
             
            