-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 15286 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSH1
-
Backbone manufacturerGR Crabtree lab
- Backbone size w/o insert (bp) 3500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFGFR2 kinase, FKBP12v36
-
Alt namekgfr
-
Alt namebek
-
Alt namecek-3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2020
-
MutationFGFR2 cytoplasmic domain FKBP12 F36V
-
Entrez GeneFgfr2 (a.k.a. Bek, Fgfr-2, Fgfr-7, Fgfr2b, Fgfr7, KGFR, KGFRTr, svs)
-
Tags
/ Fusion Proteins
- ha (C terminal on insert)
- Myristoylation-targeting domain c-Src (14aa) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI, SacII (not destroyed)
- 3′ cloning site MunI (not destroyed)
- 5′ sequencing primer gaggtgttacttctgctctaaaagc
- 3′ sequencing primer cactgcattctagttgtggtttg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSH1/M-FGFR2-Fv-Fvls-E was a gift from David Spencer (Addgene plasmid # 15286 ; http://n2t.net/addgene:15286 ; RRID:Addgene_15286) -
For your References section:
Conditional activation of fibroblast growth factor receptor (FGFR) 1, but not FGFR2, in prostate cancer cells leads to increased osteopontin induction, extracellular signal-regulated kinase activation, and in vivo proliferation. Freeman KW, Gangula RD, Welm BE, Ozen M, Foster BA, Rosen JM, Ittmann M, Greenberg NM, Spencer DM. Cancer Res. 2003 Oct 1. 63(19):6237-43. PubMed 14559809