Py2087ACR1
(Plasmid
#153032)
-
PurposeAnion-conducting channelrhodopsin of viral origin. Codon-optimized for mammalian expression (human/mouse).
-
Depositing Lab
-
Depositing OrganizationHumboldt-Universitaet zu Berlin
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 153032 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 153032-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 153032-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C1
- Backbone size w/o insert (bp) 3986
- Total vector size (bp) 6278
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePy2087ACR1
-
SpeciesPyramimonas spec.
-
Insert Size (bp)1575
-
GenBank IDMT353681
- Promoter CMV (+ enhancer)
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BshTI (not destroyed)
- 5′ sequencing primer CMV-fwd: GCAAATGGGCGGTAGGCGT or EGFP-N1-fwd: GAGGTCTATATAAGCAGAGC
- 3′ sequencing primer EGFP-C1-rev: AACCATTATAAGCTGCAATAAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 153032-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 153032-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Py2087ACR1 was a gift from Peter Hegemann (Addgene plasmid # 153032 ; http://n2t.net/addgene:153032 ; RRID:Addgene_153032) -
For your References section:
Lateral Gene Transfer of Anion-Conducting Channelrhodopsins between Green Algae and Giant Viruses. Rozenberg A, Oppermann J, Wietek J, Fernandez Lahore RG, Sandaa RA, Bratbak G, Hegemann P, Beja O. Curr Biol. 2020 Dec 21;30(24):4910-4920.e5. doi: 10.1016/j.cub.2020.09.056. Epub 2020 Oct 15. 10.1016/j.cub.2020.09.056 PubMed 33065010