Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

(Plasmid #153032)


Item Catalog # Description Quantity Price (USD)
Plasmid 153032 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3986
  • Total vector size (bp) 6278
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    Pyramimonas spec.
  • Insert Size (bp)
  • GenBank ID
  • Promoter CMV (+ enhancer)
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BshTI (not destroyed)
  • 3′ sequencing primer EGFP-C1-rev: AACCATTATAAGCTGCAATAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Py2087ACR1 was a gift from Peter Hegemann (Addgene plasmid # 153032 ; ; RRID:Addgene_153032)
  • For your References section:

    Lateral Gene Transfer of Anion-Conducting Channelrhodopsins between Green Algae and Giant Viruses. Rozenberg A, Oppermann J, Wietek J, Fernandez Lahore RG, Sandaa RA, Bratbak G, Hegemann P, Beja O. Curr Biol. 2020 Dec 21;30(24):4910-4920.e5. doi: 10.1016/j.cub.2020.09.056. Epub 2020 Oct 15. 10.1016/j.cub.2020.09.056 PubMed 33065010