pAM-AAV-mSncg-Cre
(Plasmid
#153207)
-
PurposeMouse gamma-synuclein (mSncg) promoter-mediates Cre expression in retinal ganglion cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 153207 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5816
- Total vector size (bp) 6845
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCre
-
Insert Size (bp)1029
- Promoter mSncg
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gcaaacaccatggacgtcttcaaggaattcGCCACCATGcccaagaagaagaggaaggtg
- 3′ sequencing primer ccgggtcgactctagaggtaccacgcgtagatctctaatcgccatcttccagcaggc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM-AAV-mSncg-Cre was a gift from Yang Hu (Addgene plasmid # 153207 ; http://n2t.net/addgene:153207 ; RRID:Addgene_153207) -
For your References section:
Mouse gamma-Synuclein Promoter-Mediated Gene Expression and Editing in Mammalian Retinal Ganglion Cells. Wang Q, Zhuang PS, Huang H, Li L, Liu L, Webber HC, Dalal R, Siew L, Fligor CM, Chang KC, Nahmou M, Kreymerman A, Sun Y, Meyer JS, Goldberg JL, Hu Y. J Neurosci. 2020 Apr 9. pii: JNEUROSCI.0102-20.2020. doi: 10.1523/JNEUROSCI.0102-20.2020. 10.1523/JNEUROSCI.0102-20.2020 PubMed 32300046