-
PurposeNew color variant of Fucci (Fluorescent ubiquitination-based cell cycle indicator) : Fucci(CA)5.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153521 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPBbsr2
-
Backbone manufacturerSanger Institute
- Total vector size (bp) 8932
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametFucci(CA)5.
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2178
-
GenBank IDLC334438
- Promoter CAG
-
Tag
/ Fusion Protein
- AzaleaB5-hCdt1(1/100)Cy(-)_P2A_h2-3-hGem(1/110)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer GATCCGCCACCATGGAGAACGTCAGGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2020.03.30.015156 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tFucci(CA)5 was a gift from Atsushi Miyawaki (Addgene plasmid # 153521 ; http://n2t.net/addgene:153521 ; RRID:Addgene_153521) -
For your References section:
Two coral fluorescent proteins of distinct colors for sharp visualization of cell-cycle progression. Ando R, Sakaue-Sawano A, Shoda K, Miyawaki A. Cell Struct Funct. 2023 Jun 30. doi: 10.1247/csf.23028. 10.1247/csf.23028 PubMed 37394513