pDONR223 SARS-CoV-2 S 24nt-del_nostop
(Plasmid
#153953)
-
PurposeGateway-compatible Entry vector, with insert of S CDS bearing a 24nt deletion from SARS-CoV-2 genomic analysis in Davidson et al. 2020
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 153953 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepDONR223
-
Backbone manufacturerRual et al, Genome Res. 14:2128-2135, 2004.
- Backbone size w/o insert (bp) 5005
-
Vector typeGateway-compatible Entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameS
-
SpeciesSARS-CoV-2 isolate Wuhan-Hu-1
-
Insert Size (bp)3795
-
MutationMany synonymous changes due to codon optimization
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGAACAAGTGCGTGAACTTC
- 3′ sequencing primer M13R
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Kim et al. 2020 can be accessed at https://doi.org/10.1016/j.cell.2020.04.011
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONR223 SARS-CoV-2 S 24nt-del_nostop was a gift from Fritz Roth (Addgene plasmid # 153953 ; http://n2t.net/addgene:153953 ; RRID:Addgene_153953) -
For your References section:
A Comprehensive, Flexible Collection of SARS-CoV-2 Coding Regions. Kim DK, Knapp JJ, Kuang D, Chawla A, Cassonnet P, Lee H, Sheykhkarimli D, Samavarchi-Tehrani P, Abdouni H, Rayhan A, Li R, Pogoutse O, Coyaud E, van der Werf S, Demeret C, Gingras AC, Taipale M, Raught B, Jacob Y, Roth FP. G3 (Bethesda). 2020 Aug 6. pii: g3.120.401554. doi: 10.1534/g3.120.401554. 10.1534/g3.120.401554 PubMed 32763951