Skip to main content
Addgene

EC71174
(Plasmid #154067)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154067 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    EC15027
  • Backbone manufacturer
    ENSA
  • Backbone size w/o insert (bp) 4834
  • Total vector size (bp) 13415
  • Vector type
    Bacterial Expression, Plant Expression, Cre/Lox, Synthetic Biology ; Golden Gate
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    HS Cre recombinase
  • Alt name
    HS::CRE
  • Species
    A. thaliana (mustard weed), Synthetic; Enterobacteria Phage P1, Hordeum vulgare heat shock promoter from pHSPdGUS (Freeman et al 2011, Plant Biotech Journal)
  • Insert Size (bp)
    2134
  • Mutation
    The Arabidopsis thaliana U5 small nuclear ribonucleoprotein component intron from pICSL80006 (TSL SynBio) is inserted at 254bp in the Cre recombinase. BsaI, Esp3I and BpiI restriction sites were removed using synonymous changes.
  • GenBank ID
    NM_2777477
  • Promoter Hordeum vulgare HSP 17 promoter used in Freeman et al 2011 Plant Biotechnology Journal pHSPdGUS

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer GATGGTGCATGGACCACCCGGA
  • 3′ sequencing primer ACCAGAGTGTCGTGCTCCACCA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Ubiquitin promoter driving mCherry with the 35S terminator, flanked by lox sites, followed by eGFP with the Actin terminator
  • Alt name
    ZmUbi::lox-mCHERRY-T35S-lox-eGFP-TAct
  • Species
    A. thaliana (mustard weed), Synthetic; Hordeum vulgare (heat shock promoter), Zea mays (Ubiquitin promoter)
  • Insert Size (bp)
    4414
  • Promoter Zea mays Ubiquitin promoter with intron

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer GCACATACAAATGGACGAAC
  • 3′ sequencing primer ACCCAGAGAGTTTGTCACACACA
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    HYGROMYCIN Resistance Cassette
  • Alt name
    HYG
  • Alt name
    HPT
  • Alt name
    35S promoter driving HYG resistance gene with the NOS terminator
  • Species
    Synthetic
  • Insert Size (bp)
    1909
  • Promoter 35S promoter

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer TAACATAGATGACACCGCGCGCG
  • 3′ sequencing primer TGGTGGAGCACGACACTCTGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EC71174 was a gift from Cristobal Uauy (Addgene plasmid # 154067 ; http://n2t.net/addgene:154067 ; RRID:Addgene_154067)
  • For your References section:

    A heat-shock inducible system for flexible gene expression in cereals. Harrington SA, Backhaus AE, Fox S, Rogers C, Borrill P, Uauy C, Richardson A. Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020. 10.1186/s13007-020-00677-3 PubMed 33072173