pMG051 MBP-β-catenin-His, GST-CK1α
(Plasmid
#154072)
-
PurposeCo-expresses MBP-β-catenin-His (human β-catenin as a fusion protein with MBP and His- tags) and GST_CK1α in E.coli to produce primed MBP-β-catenin-His
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154072 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMBP-MG
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 6716
- Total vector size (bp) 10852
-
Modifications to backboneModified to include an N-terminal TEV-cleavable MBP tag and a C-terminal His6 tag
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCTNNB1
-
Alt nameβ-catenin
-
Alt nameBeta-catenin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2343
-
GenBank IDAY463360
-
Entrez GeneCTNNB1 (a.k.a. CTNNB, EVR7, MRD19, NEDSDV, armadillo)
- Promoter Tac
-
Tags
/ Fusion Proteins
- MBP (N terminal on backbone)
- His6 (C terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer MalE Forward GGTCGTCAGACTGTCGATGAAGCC
- 3′ sequencing primer GST_N Reverse GAGTGGGTTGCACAAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCSNK1A1
-
Alt nameCasein kinase I isoform alpha
-
Insert Size (bp)1014
-
GenBank IDAK294942
-
Entrez GeneCSNK1A1 (a.k.a. CK1, CK1a, CKIa, HEL-S-77p, HLCDGP1, PRO2975)
- Promoter Tac
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer pGEX 5' GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer M13F Reverse TGTAAAACGACGGCCAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene #14753, Addgene #92014
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
BamHI restriction site between MBP and B-catenin insert, NotI restriction site between B-catenin insert and His6-tag, SalI restriction site between GST and CK1a insert, PstI restriction site after CK1a stop.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMG051 MBP-β-catenin-His, GST-CK1α was a gift from Jesse Zalatan (Addgene plasmid # 154072 ; http://n2t.net/addgene:154072 ; RRID:Addgene_154072) -
For your References section:
The Scaffold Protein Axin Promotes Signaling Specificity within the Wnt Pathway by Suppressing Competing Kinase Reactions. Gavagan M, Fagnan E, Speltz EB, Zalatan JG. Cell Syst. 2020 Jun 24;10(6):515-525.e5. doi: 10.1016/j.cels.2020.05.002. Epub 2020 Jun 17. 10.1016/j.cels.2020.05.002 PubMed 32553184