pMG046 pETARA-CK1α-His
(Plasmid
#154074)
-
PurposeExpresses GST_CK1α (human CK1α as a fusion protein with GST and His- tags) in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154074 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepETARA
- Backbone size w/o insert (bp) 4354
- Total vector size (bp) 5365
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCSNK1A1
-
Alt nameCasein kinase I isoform alpha
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1011
-
Entrez GeneCSNK1A1 (a.k.a. CK1, CK1a, CKIa, HEL-S-77p, HLCDGP1, PRO2975)
- Promoter T7
-
Tags
/ Fusion Proteins
- GST (N terminal on backbone)
- His6 (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer pGEX 5' GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer T7 Reverse GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene #92014
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMG046 pETARA-CK1α-His was a gift from Jesse Zalatan (Addgene plasmid # 154074 ; http://n2t.net/addgene:154074 ; RRID:Addgene_154074) -
For your References section:
The Scaffold Protein Axin Promotes Signaling Specificity within the Wnt Pathway by Suppressing Competing Kinase Reactions. Gavagan M, Fagnan E, Speltz EB, Zalatan JG. Cell Syst. 2020 Jun 24;10(6):515-525.e5. doi: 10.1016/j.cels.2020.05.002. Epub 2020 Jun 17. 10.1016/j.cels.2020.05.002 PubMed 32553184