Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMG046 pETARA-CK1α-His
(Plasmid #154074)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 154074 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pETARA
  • Backbone size w/o insert (bp) 4354
  • Total vector size (bp) 5365
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CSNK1A1
  • Alt name
    Casein kinase I isoform alpha
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1011
  • Entrez Gene
    CSNK1A1 (a.k.a. CK1, CK1a, CKIa, HEL-S-77p, HLCDGP1, PRO2975)
  • Promoter T7
  • Tags / Fusion Proteins
    • GST (N terminal on backbone)
    • His6 (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer pGEX 5' GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer T7 Reverse GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Addgene #92014
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMG046 pETARA-CK1α-His was a gift from Jesse Zalatan (Addgene plasmid # 154074 ; http://n2t.net/addgene:154074 ; RRID:Addgene_154074)
  • For your References section:

    The Scaffold Protein Axin Promotes Signaling Specificity within the Wnt Pathway by Suppressing Competing Kinase Reactions. Gavagan M, Fagnan E, Speltz EB, Zalatan JG. Cell Syst. 2020 Jun 24;10(6):515-525.e5. doi: 10.1016/j.cels.2020.05.002. Epub 2020 Jun 17. 10.1016/j.cels.2020.05.002 PubMed 32553184