Skip to main content

pMG046 pETARA-CK1α-His
(Plasmid #154074)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154074 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pETARA
  • Backbone size w/o insert (bp) 4354
  • Total vector size (bp) 5365
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CSNK1A1
  • Alt name
    Casein kinase I isoform alpha
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1011
  • Entrez Gene
    CSNK1A1 (a.k.a. CK1, CK1a, CKIa, HEL-S-77p, HLCDGP1, PRO2975)
  • Promoter T7
  • Tags / Fusion Proteins
    • GST (N terminal on backbone)
    • His6 (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer pGEX 5' GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer T7 Reverse GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene #92014

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMG046 pETARA-CK1α-His was a gift from Jesse Zalatan (Addgene plasmid # 154074 ; http://n2t.net/addgene:154074 ; RRID:Addgene_154074)
  • For your References section:

    The Scaffold Protein Axin Promotes Signaling Specificity within the Wnt Pathway by Suppressing Competing Kinase Reactions. Gavagan M, Fagnan E, Speltz EB, Zalatan JG. Cell Syst. 2020 Jun 24;10(6):515-525.e5. doi: 10.1016/j.cels.2020.05.002. Epub 2020 Jun 17. 10.1016/j.cels.2020.05.002 PubMed 32553184