Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMG059 MBP-CREB-His
(Plasmid #154076)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 154076 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMBP-MG
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 6716
  • Total vector size (bp) 7739
  • Modifications to backbone
    Modified to include an N-terminal TEV-cleavable MBP tag and a C-terminal His6 tag
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CREB1
  • Alt name
    Cyclic AMP-responsive element-binding protein 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1023
  • GenBank ID
    M34356
  • Entrez Gene
    CREB1 (a.k.a. CREB, CREB-1)
  • Promoter Tac
  • Tags / Fusion Proteins
    • MBP (N terminal on backbone)
    • His6 (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer MalE Forward GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer M13F Reverse TGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Addgene #82203

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMG059 MBP-CREB-His was a gift from Jesse Zalatan (Addgene plasmid # 154076 ; http://n2t.net/addgene:154076 ; RRID:Addgene_154076)
  • For your References section:

    The Scaffold Protein Axin Promotes Signaling Specificity within the Wnt Pathway by Suppressing Competing Kinase Reactions. Gavagan M, Fagnan E, Speltz EB, Zalatan JG. Cell Syst. 2020 Jun 24;10(6):515-525.e5. doi: 10.1016/j.cels.2020.05.002. Epub 2020 Jun 17. 10.1016/j.cels.2020.05.002 PubMed 32553184