pSCIP-hTRAC
(Plasmid
#154094)
-
PurposeSelf-Cutting and Integrating CRISPR backbone targeting human TCR-alpha common chain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154094 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQCi
-
Backbone manufacturerDerived from pX458 (Zhang lab)
- Backbone size w/o insert (bp) 9500
-
Modifications to backboneModular BAIT site integrated (BsaI sites) Intron integrated into spCas9 sequence
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGFP and tdTomato
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA and BAIT targeting human TRAC locus
-
Alt nameTCTCTCAGCTGGTACACGGC
-
SpeciesH. sapiens (human)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCIP-hTRAC was a gift from Scott McComb (Addgene plasmid # 154094 ; http://n2t.net/addgene:154094 ; RRID:Addgene_154094)