pSCIP-hTRAC
(Plasmid
#154094)
-
PurposeSelf-Cutting and Integrating CRISPR backbone targeting human TCR-alpha common chain
-
Depositing Lab
-
Depositing OrganizationNational Research Council of Canada
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154094 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 154094-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 154094-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepQCi
-
Backbone manufacturerDerived from pX458 (Zhang lab)
- Backbone size w/o insert (bp) 9500
-
Modifications to backboneModular BAIT site integrated (BsaI sites) Intron integrated into spCas9 sequence
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGFP and tdTomato
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA and BAIT targeting human TRAC locus
-
Alt nameTCTCTCAGCTGGTACACGGC
-
SpeciesH. sapiens (human)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.03.25.008276v4 for bioRxiv preprint.
DNA (Catalog # 154094-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 154094-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCIP-hTRAC was a gift from Scott McComb (Addgene plasmid # 154094 ; http://n2t.net/addgene:154094 ; RRID:Addgene_154094) -
For your References section:
Self-Cutting and Integrating CRISPR Plasmids Enable Targeted Genomic Integration of Genetic Payloads for Rapid Cell Engineering. Bloemberg D, Sosa-Miranda CD, Nguyen T, Weeratna RD, McComb S. CRISPR J. 2021 Feb;4(1):104-119. doi: 10.1089/crispr.2020.0090. 10.1089/crispr.2020.0090 PubMed 33616439
