Skip to main content

pLenti PGK OGT (Neo)
(Plasmid #154289)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154289 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti PGK Neo (DEST)
  • Backbone manufacturer
    Campeau et al.
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 11717
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    O-GlcNAc Transferase
  • Alt name
    OGT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3599
  • GenBank ID
    NM_181673.3
  • Entrez Gene
    OGT (a.k.a. HINCUT-1, HRNT1, MRX106, O-GLCNAC, OGT1, XLID106)
  • Promoter PGK

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GTGTTCCGCATTCTGCAAG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2020.10.22.351288 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti PGK OGT (Neo) was a gift from Suzanne Walker (Addgene plasmid # 154289 ; http://n2t.net/addgene:154289 ; RRID:Addgene_154289)
  • For your References section:

    Mammalian cell proliferation requires noncatalytic functions of O-GlcNAc transferase. Levine ZG, Potter SC, Joiner CM, Fei GQ, Nabet B, Sonnett M, Zachara NE, Gray NS, Paulo JA, Walker S. Proc Natl Acad Sci U S A. 2021 Jan 26;118(4). pii: 2016778118. doi: 10.1073/pnas.2016778118. 10.1073/pnas.2016778118 PubMed 33419956