pLenti PGK mKate2-OGT D554N (Puro)
(Plasmid
#154292)
-
PurposeLentiviral vector encoding full length mKate2-2xFLAG-OGT (full length human O-GlcNAc transferase, D554N variant, no Ser/Thr glycosylation)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154292 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti PGK Neo (DEST)
-
Backbone manufacturerCampeau et al.
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 11717
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameO-GlcNAc Transferase
-
Alt nameOGT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3599
-
MutationD554N mutation (Ser/Thr glycosylation-incompetent)
-
GenBank IDNM_181673.3
-
Entrez GeneOGT (a.k.a. HINCUT-1, HRNT1, MRX106, O-GLCNAC, OGT1, XLID106)
- Promoter PGK
-
Tags
/ Fusion Proteins
- mKate2 (N terminal on insert)
- 2x FLAG (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GTGTTCCGCATTCTGCAAG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2020.10.22.351288 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti PGK mKate2-OGT D554N (Puro) was a gift from Suzanne Walker (Addgene plasmid # 154292 ; http://n2t.net/addgene:154292 ; RRID:Addgene_154292) -
For your References section:
Mammalian cell proliferation requires noncatalytic functions of O-GlcNAc transferase. Levine ZG, Potter SC, Joiner CM, Fei GQ, Nabet B, Sonnett M, Zachara NE, Gray NS, Paulo JA, Walker S. Proc Natl Acad Sci U S A. 2021 Jan 26;118(4). pii: 2016778118. doi: 10.1073/pnas.2016778118. 10.1073/pnas.2016778118 PubMed 33419956