-
PurposeExpresses ZIM3 KRAB domain fused to the N terminus of dCas9
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154472 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLX303
-
Backbone manufacturerDavid Root
- Total vector size (bp) 12279
-
Modifications to backbonedCas9 construct after Gateway recombination sites (C-terminal to the insert)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsGrow at 30 degrees to avoid recombination
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZIM3
-
SpeciesSynthetic
-
MutationIncludes ZIM3 aa 1-100
-
Entrez GeneZIM3 (a.k.a. ZNF264, ZNF657)
-
Tag
/ Fusion Protein
- HA (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX303-ZIM3-KRAB-dCas9 was a gift from Mikko Taipale (Addgene plasmid # 154472 ; http://n2t.net/addgene:154472 ; RRID:Addgene_154472) -
For your References section:
An efficient KRAB domain for CRISPRi applications in human cells. Alerasool N, Segal D, Lee H, Taipale M. Nat Methods. 2020 Nov;17(11):1093-1096. doi: 10.1038/s41592-020-0966-x. Epub 2020 Oct 5. 10.1038/s41592-020-0966-x PubMed 33020655