Skip to main content

pET-His-SCov2-nsp8
(Plasmid #154758)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154758 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET
  • Backbone size w/o insert (bp) 3069
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 nsp8
  • Species
    Severe acute respiratory syndrome coronavirus 2
  • Insert Size (bp)
    597
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter T7

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ATCGATCCCGCGAAATGC
  • 3′ sequencing primer CGGATATAGTTCCCTGCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-His-SCov2-nsp8 was a gift from Patrick Cramer (Addgene plasmid # 154758 ; http://n2t.net/addgene:154758 ; RRID:Addgene_154758)
  • For your References section:

    Structure of replicating SARS-CoV-2 polymerase. Hillen HS, Kokic G, Farnung L, Dienemann C, Tegunov D, Cramer P. Nature. 2020 May 21. pii: 10.1038/s41586-020-2368-8. doi: 10.1038/s41586-020-2368-8. 10.1038/s41586-020-2368-8 PubMed 32438371