pRG705_lexO-AsiSI_LexA-TF_LEU2MX
(Plasmid
#154817)
-
PurposeInducible expression of AsiSI endonuclease in S. cerevisiae
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154817 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRG205MX
-
Backbone manufacturerAddgene plasmid # 64535
- Backbone size w/o insert (bp) 5193
- Total vector size (bp) 9655
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameAsiSI endonuclease
-
Alt nameasiSIR
-
SpeciesArthrobacter sp. S
-
Insert Size (bp)1613
- Promoter lexO_4-CYC1_core
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- FLAG (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site KpnI (non-unique) (not destroyed)
- 5′ sequencing primer T7 TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameLexA-ER-B112
-
SpeciesSynthetic
-
Insert Size (bp)2926
- Promoter ACT1
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (non-unique) (not destroyed)
- 3′ cloning site KpnI (non-unique) (not destroyed)
- 5′ sequencing primer ACT1 Promoter Forward TATTTCTCTGTCACCCGGCC
- 3′ sequencing primer M13 Reverse CAGGAAACAGCTATGAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byLexA TF from FRP880 (Addgene plasmid # 58437).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Linearize plasmid with AscI for integration into the yeast genome. See Gnuegge et al., 2016 (https://pubmed.ncbi.nlm.nih.gov/26647923/) for details.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRG705_lexO-AsiSI_LexA-TF_LEU2MX was a gift from Lorraine Symington (Addgene plasmid # 154817 ; http://n2t.net/addgene:154817 ; RRID:Addgene_154817) -
For your References section:
Efficient DNA double-strand break formation at single or multiple defined sites in the Saccharomyces cerevisiae genome. Gnugge R, Symington LS. Nucleic Acids Res. 2020 Oct 14. pii: 5923424. doi: 10.1093/nar/gkaa833. 10.1093/nar/gkaa833 PubMed 33053188