pICE-HA-NLS-I-PpoI
(Plasmid #46963)

• Purpose: For constitutive or doxycycline-inducible expression of the site specific homing nuclease I-PpoI (human codon optimized). Confers resistance to puro. Use T-REx cells for doxy-inducible expression.
• Depositing Lab: Steve Jackson
• Publication: Britton et al J Cell Biol. 2013 Jul 29.

Backbone

• Vector backbone: pICE
• Backbone size w/o insert (bp): 5044
• Total vector size (bp): 5530
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NLS-I-PpoI
• Species: Physarum polycephalum
• Insert Size (bp): 570
• Promoter: CMV-TET
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HinIII (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GTAGGCGTGTACGGTGGGAGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • Author annotated GenBank sequence
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry