Skip to main content
Addgene

pCE-K2N
(Plasmid #154879)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154879 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCE
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KLF2-2A-NANOG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2079
  • Entrez Gene
    KLF2 (a.k.a. LKLF)
  • Entrez Gene
    NANOG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer agagcctctgctaaccatgt
  • 3′ sequencing primer ctattgcaatgaaaataaatttcctttatt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCE-K2N was a gift from Hideyuki Okano (Addgene plasmid # 154879 ; http://n2t.net/addgene:154879 ; RRID:Addgene_154879)
  • For your References section:

    Non-viral Induction of Transgene-free iPSCs from Somatic Fibroblasts of Multiple Mammalian Species. Yoshimatsu S, Nakajima M, Iguchi A, Sanosaka T, Sato T, Nakamura M, Nakajima R, Arai E, Ishikawa M, Imaizumi K, Watanabe H, Okahara J, Noce T, Takeda Y, Sasaki E, Behr R, Edamura K, Shiozawa S, Okano H. Stem Cell Reports. 2021 Mar 23. pii: S2213-6711(21)00132-6. doi: 10.1016/j.stemcr.2021.03.002. 10.1016/j.stemcr.2021.03.002 PubMed 33798453