CSIV-TRE-ASCL1
(Plasmid
#154883)
-
PurposeDoxycycline-dependently expresses human ASCL1.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCSIV-TRE
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameASCL1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)711
-
Entrez GeneASCL1 (a.k.a. ASH1, HASH1, MASH1, bHLHa46)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ttagtgaaccgtcagatcgc
- 3′ sequencing primer gcaatgccccaaccagtg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CSIV-TRE-ASCL1 was a gift from Hideyuki Okano (Addgene plasmid # 154883 ; http://n2t.net/addgene:154883 ; RRID:Addgene_154883) -
For your References section:
Direct Neuronal Reprogramming of Common Marmoset Fibroblasts by ASCL1, microRNA-9/9*, and microRNA-124 Overexpression. Nemoto A, Kobayashi R, Yoshimatsu S, Sato Y, Kondo T, Yoo AS, Shiozawa S, Okano H. Cells. 2020 Dec 22;10(1). pii: cells10010006. doi: 10.3390/cells10010006. 10.3390/cells10010006 PubMed 33375083