pDEST-ERBB3-v2
(Plasmid
#154894)
-
PurposeExpresses ERBB3 (a.k.a HER3) fused to Venus fragment 2 (v2) for use in bimolecular fluorescence complementation (BiFC) assays
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154894 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDEST-ORF-V2
-
Backbone manufacturerAddgene, #73638
- Backbone size w/o insert (bp) 5211
- Total vector size (bp) 7582
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameERBB3
-
Alt nameHER3
-
Alt nameerb-b2 receptor tyrosine kinase 3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4043
-
GenBank IDNM_001005915
-
Entrez GeneERBB3 (a.k.a. ErbB-3, FERLK, HER3, LCCS2, MDA-BF-1, VSCN1, c-erbB-3, c-erbB3, erbB3-S, p180-ErbB3, p45-sErbB3, p85-sErbB3)
- Promoter CMV
-
Tag
/ Fusion Protein
- Venus fragment 2 (v2) (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST-ERBB3-v2 was a gift from Johanna Ivaska (Addgene plasmid # 154894 ; http://n2t.net/addgene:154894 ; RRID:Addgene_154894) -
For your References section:
A feed-forward loop between SorLA and HER3 determines heregulin response and neratinib resistance. Al-Akhrass H, Conway JRW, Poulsen ASA, Paatero I, Kaivola J, Padzik A, Andersen OM, Ivaska J. Oncogene. 2021 Feb;40(7):1300-1317. doi: 10.1038/s41388-020-01604-5. Epub 2021 Jan 8. 10.1038/s41388-020-01604-5 PubMed 33420373