pCW-codon optimized catalytically inactive PHGDH
              
              
                (Plasmid
                
                #154903)
              
            
            
            
          - 
            PurposeExpresses codon optimized catalytically inactive PHGDH in mammalian cells
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154903 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCW57-MCS1-P2A-MCS2
- Backbone size w/o insert (bp) 7943
- Total vector size (bp) 9500
- 
              Vector typeMammalian Expression, Lentiviral
- 
                Selectable markersNeomycin (select with G418)
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert namePhosphoglycerate dehydrogenase
- 
                  Alt name3-phosphoglycerate dehydrogenase
- 
                  Alt namePHGDH
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)1629
- 
                  MutationThree mutations: D175N, R236K, H283A
- 
                    GenBank IDNM_006623.4
- 
                        Entrez GenePHGDH (a.k.a. 3-PGDH, 3PGDH, HEL-S-113, NLS, NLS1, PDG, PGAD, PGD, PGDH, PHGDHD, SERA)
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer GAACGGACGTGAAGAATGTG (Common Sequencing Primers)
Resource Information
- 
            Article Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pCW-codon optimized catalytically inactive PHGDH was a gift from Michael Pacold (Addgene plasmid # 154903 ; http://n2t.net/addgene:154903 ; RRID:Addgene_154903)
- 
                For your References section: Limited Environmental Serine and Glycine Confer Brain Metastasis Sensitivity to PHGDH Inhibition. Ngo B, Kim E, Osorio-Vasquez V, Doll S, Bustraan S, Liang RJ, Luengo A, Davidson SM, Ali A, Ferraro GB, Fischer GM, Eskandari R, Kang DS, Ni J, Plasger A, Rajasekhar VK, Kastenhuber ER, Bacha S, Sriram RK, Stein BD, Bakhoum SF, Snuderl M, Cotzia P, Healey JH, Mainolfi N, Suri V, Friedman A, Manfredi M, Sabatini DM, Jones DR, Yu M, Zhao JJ, Jain RK, Keshari KR, Davies MA, Vander Heiden MG, Hernando E, Mann M, Cantley LC, Pacold ME. Cancer Discov. 2020 Sep;10(9):1352-1373. doi: 10.1158/2159-8290.CD-19-1228. Epub 2020 Jun 22. 10.1158/2159-8290.CD-19-1228 PubMed 32571778
