Skip to main content

pSLQ5080_pHR_PGK_sfGFP_CoV-F2
(Plasmid #155304)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155304 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Backbone size w/o insert (bp) 8965
  • Total vector size (bp) 11705
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Superfolder GFP fused with SARS-CoV-2 fluorescent reporter 2
  • Alt name
    SFGFP
  • Alt name
    SARS-CoV-F2
  • Species
    Synthetic
  • Insert Size (bp)
    2740
  • Entrez Gene
    N (a.k.a. GU280_gp10)
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter PGK

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATTCTGCACGCTTCAAAAG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: The plasmid contains a single A nucleotide deletion in the SARS-CoV-2 N gene ORF that causes a frameshift and early termination. This change is not expected to affect plasmid function as the only ORF on the plasmid is sfGFP (the RdRP and N gene fragments occur after the stop codon and are in the 3'UTR of sfGFP).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ5080_pHR_PGK_sfGFP_CoV-F2 was a gift from Stanley Qi (Addgene plasmid # 155304 ; http://n2t.net/addgene:155304 ; RRID:Addgene_155304)
  • For your References section:

    Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and Influenza. Abbott TR, Dhamdhere G, Liu Y, Lin X, Goudy L, Zeng L, Chemparathy A, Chmura S, Heaton NS, Debs R, Pande T, Endy D, La Russa MF, Lewis DB, Qi LS. Cell. 2020 May 14;181(4):865-876.e12. doi: 10.1016/j.cell.2020.04.020. Epub 2020 Apr 29. 10.1016/j.cell.2020.04.020 PubMed 32353252