Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSLQ5429_pUC_hU6-crScaffold_EF1a-BFP
(Plasmid #155306)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 155306 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 1807
  • Total vector size (bp) 4359
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rfx Cas13d CRISPR RNA BFP
  • Alt name
    Rfx Cas13d crRNA
  • gRNA/shRNA sequence
    n/a
  • Species
    Synthetic
  • Promoter hU6, EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer ATAATACCGCGCCACATAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid derived from Addgene #109054. Clone new guides by digesting with BbsI then annealing, ligating oligos with desired spacer.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ5429_pUC_hU6-crScaffold_EF1a-BFP was a gift from Stanley Qi (Addgene plasmid # 155306 ; http://n2t.net/addgene:155306 ; RRID:Addgene_155306)
  • For your References section:

    Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and Influenza. Abbott TR, Dhamdhere G, Liu Y, Lin X, Goudy L, Zeng L, Chemparathy A, Chmura S, Heaton NS, Debs R, Pande T, Endy D, La Russa MF, Lewis DB, Qi LS. Cell. 2020 May 14;181(4):865-876.e12. doi: 10.1016/j.cell.2020.04.020. Epub 2020 Apr 29. 10.1016/j.cell.2020.04.020 PubMed 32353252