pSLQ5428_pHR_EF1a-mCherry-P2A-Rfx_Cas13d-2xNLS-3xFLAG
(Plasmid #155305)

• Purpose: Lentiviral vector encoding Rfx Cas13d fused with 2xNLS, 3xFLAG, and 2A-tagged mCherry.
• Depositing Lab: Stanley Qi
• Publication: Abbott et al Cell. 2020 May 14;181(4):865-876.e12. doi: 10.1016/j.cell.2020.04.020. Epub 2020 Apr 29.

Backbone

• Vector backbone: pHR
• Backbone size w/o insert (bp): 9735
• Total vector size (bp): 13551
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: It may take up to 2 days for bacteria containing this plasmid to grow well on plates or in liquid culture
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry 2A-tagged to Ruminococcus flavefaciens XPD3002 Cas13d
• Alt name: RfxCas13d
• Alt name: CasRx
• Species: Synthetic
• Insert Size (bp): 3816
• Promoter: EF1a
• Tag / Fusion Protein:
  • 2xNLS-3xFLAG (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pSLQ5428_pHR_EF1a-mCherry-P2A-Rfx_Cas13d-2xNLS-3xFLAG.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry