Skip to main content

gNS2B47NS3 L30SF31S
(Plasmid #155316)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155316 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pProExHTb
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4779
  • Total vector size (bp) 6806
  • Modifications to backbone
    NA
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DENV4 NS3 full length protein linked with 47 peptides from NS2B cofactor
  • Alt name
    NS2B47NS3
  • Species
    Dengue virus 4
  • Mutation
    L30 to S, F31 to S
  • GenBank ID
    JF262783 G11337
  • Promoter M13
  • Tag / Fusion Protein
    • His tag (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AGCGGATAACAATTTCACACAGG
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Prof. Subhash Vasudevan Lab, DUKE-NUS medical school, Singapore

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

original plasmid received from SV lab. L30S F31S mutations performed at DL lab.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gNS2B47NS3 L30SF31S was a gift from Dahai Luo (Addgene plasmid # 155316 ; http://n2t.net/addgene:155316 ; RRID:Addgene_155316)
  • For your References section:

    Crystal structures of full length DENV4 NS2B-NS3 reveal the dynamic interaction between NS2B and NS3. Phoo WW, El Sahili A, Zhang Z, Chen MW, Liew CW, Lescar J, Vasudevan SG, Luo D. Antiviral Res. 2020 Oct;182:104900. doi: 10.1016/j.antiviral.2020.104900. Epub 2020 Aug 5. 10.1016/j.antiviral.2020.104900 PubMed 32763315