Skip to main content
Addgene

pNBA002
(Plasmid #155324)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 155324 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Xpre2-S
  • Vector type
    Synthetic Biology ; Eukaryotic Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    The operator repetitions can be lost after bacterial propagation. It is recommended to grow the bacteria at 30°C and sequence the repeats after new DNA preparations.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LB_(etr)8-(C120)5-PhCMVmin-GBP-mCherry-T35S_RB
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer ctgcctgtatcgagtggtga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNBA002 was a gift from Matias Zurbriggen (Addgene plasmid # 155324 ; http://n2t.net/addgene:155324 ; RRID:Addgene_155324)
  • For your References section:

    Optogenetic control of gene expression in plants in the presence of ambient white light. Ochoa-Fernandez R, Abel NB, Wieland FG, Schlegel J, Koch LA, Miller JB, Engesser R, Giuriani G, Brandl SM, Timmer J, Weber W, Ott T, Simon R, Zurbriggen MD. Nat Methods. 2020 Jul;17(7):717-725. doi: 10.1038/s41592-020-0868-y. Epub 2020 Jun 29. 10.1038/s41592-020-0868-y PubMed 32601426
Commonly requested with: