Skip to main content

pOPINO_NbH11-H4
(Plasmid #155364)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 155364 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pOPINO
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Please use WK6 bacterial strain for expression: 37 C, with induction of protein expression by 1mM IPTG at OD ~ 1.2, and then grown overnight at 20 C
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    H11-H4
  • Species
    Synthetic
  • Promoter T7
  • Tag / Fusion Protein
    • His6 (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GTGGGTATTTGTGAGCCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOPINO_NbH11-H4 was a gift from Ray Owens (Addgene plasmid # 155364 ; http://n2t.net/addgene:155364 ; RRID:Addgene_155364)
  • For your References section:

    Neutralizing nanobodies bind SARS-CoV-2 spike RBD and block interaction with ACE2. Huo J, Le Bas A, Ruza RR, Duyvesteyn HME, Mikolajek H, Malinauskas T, Tan TK, Rijal P, Dumoux M, Ward PN, Ren J, Zhou D, Harrison PJ, Weckener M, Clare DK, Vogirala VK, Radecke J, Moynie L, Zhao Y, Gilbert-Jaramillo J, Knight ML, Tree JA, Buttigieg KR, Coombes N, Elmore MJ, Carroll MW, Carrique L, Shah PNM, James W, Townsend AR, Stuart DI, Owens RJ, Naismith JH. Nat Struct Mol Biol. 2020 Jul 13. pii: 10.1038/s41594-020-0469-6. doi: 10.1038/s41594-020-0469-6. 10.1038/s41594-020-0469-6 PubMed 32661423