-
PurposeExpresses dCas9-KRAB-MeCP2 fusion driven by human SYN promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155365 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang Addgene plasmid #52961
- Backbone size w/o insert (bp) 7958
- Total vector size (bp) 13451
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-KRAB-MeCP2
-
SpeciesSynthetic
-
Insert Size (bp)5445
- Promoter SYN
-
Tags
/ Fusion Proteins
- 3x FLAG (N terminal on insert)
- 7x His (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCGACCGGAAGAGGTACAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bydCas9-KRAB-MeCP2 was a gift from Alejandro Chavez & George Church (Addgene plasmid # 110821 ; http://n2t.net/addgene:110821 ; RRID:Addgene_110821)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Full cloning information and validation can be found in preprint on BioRxiv. doi: https://doi.org/10.1101/2020.05.26.116822
https://www.biorxiv.org/content/10.1101/2020.05.26.116822v1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti SYN-dCas9-KRAB-MeCP2 was a gift from Jeremy Day (Addgene plasmid # 155365 ; http://n2t.net/addgene:155365 ; RRID:Addgene_155365) -
For your References section:
An Improved CRISPR/dCas9 Interference Tool for Neuronal Gene Suppression. Duke CG, Bach SV, Revanna JS, Sultan FA, Southern NT, Davis MN, Carullo NVN, Bauman AJ, Phillips RA 3rd, Day JJ. Front Genome Ed. 2020 Sep 15;2:9. doi: 10.3389/fgeed.2020.00009. eCollection 2020. 10.3389/fgeed.2020.00009 PubMed 34713218