-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 15567 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMSCV
- Backbone size w/o insert (bp) 5300
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFKBP12(V36)-p30Caspase9
-
Alt nameiCaspase9
-
Alt nameiCasp9M
-
Alt nameFKBP1A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1250
-
MutationFKBP12 F36 to V Truncated Caspase9 (135-416; lacking pro-domain)
-
GenBank IDAH002818 NM_001229
-
Entrez GeneFKBP1A (a.k.a. FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE)
-
Tags
/ Fusion Proteins
- HA epitope (C terminal on insert)
- FKBP12 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer cccttgaacctcctcgttcgac
- 3′ sequencing primer cgctttaaatttgcgcatgctagc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Based on L. Fan et al (99) Human Gene Therapy
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-F-del Casp9.IRES.GFP was a gift from David Spencer (Addgene plasmid # 15567 ; http://n2t.net/addgene:15567 ; RRID:Addgene_15567) -
For your References section:
An inducible caspase 9 safety switch for T-cell therapy. Straathof KC, Pule MA, Yotnda P, Dotti G, Vanin EF, Brenner MK, Heslop HE, Spencer DM, Rooney CM. Blood. 2005 Jun 1. 105(11):4247-54. 10.1182/blood-2004-11-4564 PubMed 15728125