JDW 829 (pTol2-kdrl:V5-mTagBFP2-hsKRAS4A-G12D-ac/Y)
(Plasmid
#156415)
-
Purposekdrl promoter driving V5-tagged mTagBFP2 fused to human KRAS4A-G12D with an alpha-crystallin Venus (YFP) reporter flanked by Tol2 sites
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 156415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDEST_Tol2
- Backbone size w/o insert (bp) 12248
-
Vector typeZebrafish Transgenesis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman mutant KRAS4A-G12D
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1417
-
Mutationmutant KRAS4A-G12D
-
GenBank IDNM_033360.4
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RALD2, RASK2, c-Ki-ras, c-Ki-ras2)
- Promoter kdrl
-
Tag
/ Fusion Protein
- mTagBFP2 (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer V5 REV: 5'-CGTAGAATCGAGACCGAGG; V5 FWD: 5'-GGTAAGCCTATCCCTAACCC
- 3′ sequencing primer KRAS REV2: ctgtattgtcggatctccctc; KRAS FWD2: 5'-gagggagatccgacaatacag;
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
JDW 829 (pTol2-kdrl:V5-mTagBFP2-hsKRAS4A-G12D-ac/Y) was a gift from Joshua Wythe (Addgene plasmid # 156415 ; http://n2t.net/addgene:156415 ; RRID:Addgene_156415) -
For your References section:
Somatic Gain of KRAS Function in the Endothelium is Sufficient to Cause Vascular Malformations that Require MEK but not PI3K Signaling. Fish JE, Flores-Suarez CP, Boudreau E, Herman AM, Gutierrez MC, Gustafson D, DiStefano PV, Cui M, Chen Z, Berman De Ruiz K, Schexnayder TS, Ward CS, Radovanovic I, Wythe JD. Circ Res. 2020 Jun 17. doi: 10.1161/CIRCRESAHA.119.316500. 10.1161/CIRCRESAHA.119.316500 PubMed 32552404