Skip to main content

pmGFP-Sec16L
(Plasmid #15776)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 15776 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmGFP-c1 ( modified from pEGFP-c1)
  • Backbone manufacturer
    Glick Lab
  • Backbone size w/o insert (bp) 4731
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sec16L
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    6465
  • Mutation
    K466R
  • GenBank ID
    DQ903855
  • Entrez Gene
    SEC16A (a.k.a. KIAA0310, SEC16L, p250)
  • Tag / Fusion Protein
    • mGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site Sma I (destroyed during cloning)
  • 5′ sequencing primer catggtcctgctggagttcgt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that we have identified a K466R missense mutation in the Sec16L/Sec16A region of this plasmid, and the start codon may not have been correctly identified when constructing this plasmid which may have resulted in the gene being truncated. However, we do not think that this should impact plasmid functionality.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmGFP-Sec16L was a gift from Benjamin Glick (Addgene plasmid # 15776 ; http://n2t.net/addgene:15776 ; RRID:Addgene_15776)
  • For your References section:

    Two mammalian Sec16 homologues have nonredundant functions in endoplasmic reticulum (ER) export and transitional ER organization. Bhattacharyya D, Glick BS. Mol Biol Cell. 2007 Mar;18(3):839-49. doi: 10.1091/mbc.e06-08-0707 10.1091/mbc.e06-08-0707 PubMed 17192411