-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 15776 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmGFP-c1 ( modified from pEGFP-c1)
-
Backbone manufacturerGlick Lab
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSec16L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6465
-
MutationK466R
-
GenBank IDDQ903855
-
Entrez GeneSEC16A (a.k.a. KIAA0310, SEC16L, p250)
-
Tag
/ Fusion Protein
- mGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site Sma I (destroyed during cloning)
- 5′ sequencing primer catggtcctgctggagttcgt
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that we have identified a K466R missense mutation in the Sec16L/Sec16A region of this plasmid, and the start codon may not have been correctly identified when constructing this plasmid which may have resulted in the gene being truncated. However, we do not think that this should impact plasmid functionality.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmGFP-Sec16L was a gift from Benjamin Glick (Addgene plasmid # 15776 ; http://n2t.net/addgene:15776 ; RRID:Addgene_15776) -
For your References section:
Two mammalian Sec16 homologues have nonredundant functions in endoplasmic reticulum (ER) export and transitional ER organization. Bhattacharyya D, Glick BS. Mol Biol Cell. 2007 Mar;18(3):839-49. doi: 10.1091/mbc.e06-08-0707 10.1091/mbc.e06-08-0707 PubMed 17192411