pCMV ShadowG-AURKA K162M-mTurq2
(Plasmid
#157769)
-
PurposeExpression of AuroraA kinase-dead biosensor under CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV mTurquoise2-shadowG tandem
-
Backbone manufacturerTramier
- Backbone size w/o insert (bp) 5415
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAURKA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1223
-
MutationAURKA K162M is a kinase-dead version of AURKA
-
Entrez GeneAURKA (a.k.a. AIK, ARK1, AURA, BTAK, PPP1R47, STK15, STK6, STK7)
- Promoter CMV
-
Tags
/ Fusion Proteins
- shadowG (N terminal on insert)
- mTurquoise2 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer TTTAAAGCAAGTAAAACCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV ShadowG-AURKA K162M-mTurq2 was a gift from Marc Tramier (Addgene plasmid # 157769 ; http://n2t.net/addgene:157769 ; RRID:Addgene_157769) -
For your References section:
Aurora kinase A localises to mitochondria to control organelle dynamics and energy production. Bertolin G, Bulteau AL, Alves-Guerra MC, Burel A, Lavault MT, Gavard O, Le Bras S, Gagne JP, Poirier GG, Le Borgne R, Prigent C, Tramier M. eLife. 2018 Aug 2;7. pii: 38111. doi: 10.7554/eLife.38111. 10.7554/eLife.38111 PubMed 30070631