Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCMV ShadowY-AURKA K162M-mTurq2
(Plasmid #157771)


Item Catalog # Description Quantity Price (USD)
Plasmid 157771 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pCMV mTurquoise2-shadowY tandem
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5415
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    AURKA K162M is a kinase-dead version of AURKA
  • Entrez Gene
    AURKA (a.k.a. AIK, ARK1, AURA, BTAK, PPP1R47, STK15, STK6, STK7)
  • Promoter CMV
  • Tags / Fusion Proteins
    • shadowY (N terminal on insert)
    • mTurquoise2 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer pCMV
  • 3′ sequencing primer TTTAAAGCAAGTAAAACCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV ShadowY-AURKA K162M-mTurq2 was a gift from Marc Tramier (Addgene plasmid # 157771 ; ; RRID:Addgene_157771)
  • For your References section:

    Aurora kinase A localises to mitochondria to control organelle dynamics and energy production. Bertolin G, Bulteau AL, Alves-Guerra MC, Burel A, Lavault MT, Gavard O, Le Bras S, Gagne JP, Poirier GG, Le Borgne R, Prigent C, Tramier M. Elife. 2018 Aug 2;7. pii: 38111. doi: 10.7554/eLife.38111. 10.7554/eLife.38111 PubMed 30070631