Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #157793)


Item Catalog # Description Quantity Price (USD)
Plasmid 157793 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
  • Promoter T7
  • Tag / Fusion Protein
    • His6 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site promA(NcoI) promB(NdeI) (not destroyed)
  • 3′ cloning site promA(NotI) promB(XhoI) (not destroyed)
  • 5′ sequencing primer gtccggcgtagaggatcgagatcg, gtacacggccgcataatcgaaattaatacgactcac
  • 3′ sequencing primer gtgagtcgtattaatttcgattatgcggccgtgtac, ctgcgctagtagacgagtccatgtgc
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

ySIR2 required for expression & purification - A synthetic ORF encoding the histone deacetylase domain of S. cerevisiae protein SIR2 was amplified from a dsDNA synthesized by IDT using PCR and primers adding a 5'-proximal translation start codon and a 3'-proximal translation stop codon and XhoI restriction endonuclease recognition site. XhoI restriction endonuclease (NEB) digested PCR product encoding amino acids 87-562 of wild-type SIR2 was cloned into the pETduet-1 expression vector (Novagen) using a XhoI and a blunted NdeI restriction endonuclease digestion site (NEB).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETduet+p300HAT was a gift from Michael Rosen (Addgene plasmid # 157793 ; ; RRID:Addgene_157793)
  • For your References section:

    Organization of Chromatin by Intrinsic and Regulated Phase Separation. Gibson BA, Doolittle LK, Schneider MWG, Jensen LE, Gamarra N, Henry L, Gerlich DW, Redding S, Rosen MK. Cell. 2019 Oct 3;179(2):470-484.e21. doi: 10.1016/j.cell.2019.08.037. Epub 2019 Sep 19. 10.1016/j.cell.2019.08.037 PubMed 31543265