pETduet+sfGFP-TetR-p300HAT
(Plasmid
#157795)
-
PurposeExpression of sfGFP-TetR-p300HAT fusion protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157795 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepETduet
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesfGFP-TetR-p300
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4226
-
Entrez GeneEP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
- Promoter T7
-
Tag
/ Fusion Protein
- His6 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site promA(NcoI) promB(NdeI) (not destroyed)
- 3′ cloning site promA(NotI) promB(XhoI) (not destroyed)
- 5′ sequencing primer gtccggcgtagaggatcgagatcg, gtacacggccgcataatcgaaattaatacgactcac
- 3′ sequencing primer gtgagtcgtattaatttcgattatgcggccgtgtac, ctgcgctagtagacgagtccatgtgc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ySIR2 required for expression & purification - A synthetic ORF encoding the histone deacetylase domain of S. cerevisiae protein SIR2 was amplified from a dsDNA synthesized by IDT using PCR and primers adding a 5'-proximal translation start codon and a 3'-proximal translation stop codon and XhoI restriction endonuclease recognition site. XhoI restriction endonuclease (NEB) digested PCR product encoding amino acids 87-562 of wild-type SIR2 was cloned into the pETduet-1 expression vector (Novagen) using a XhoI and a blunted NdeI restriction endonuclease digestion site (NEB).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETduet+sfGFP-TetR-p300HAT was a gift from Michael Rosen (Addgene plasmid # 157795 ; http://n2t.net/addgene:157795 ; RRID:Addgene_157795) -
For your References section:
Organization of Chromatin by Intrinsic and Regulated Phase Separation. Gibson BA, Doolittle LK, Schneider MWG, Jensen LE, Gamarra N, Henry L, Gerlich DW, Redding S, Rosen MK. Cell. 2019 Oct 3;179(2):470-484.e21. doi: 10.1016/j.cell.2019.08.037. Epub 2019 Sep 19. 10.1016/j.cell.2019.08.037 PubMed 31543265