Skip to main content

IMPT-10314:GABBR2
(Plasmid #157851)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157851 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac1
  • Backbone manufacturer
    ThermoFisher
  • Backbone size w/o insert (bp) 4776
  • Total vector size (bp) 4776
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GABBR2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2475
  • Entrez Gene
    GABBR2 (a.k.a. DEE59, EIEE59, GABABR2, GPR51, GPRC3B, HG20, HRIHFB2099, NDPLHS)
  • Promoter Polyhedrin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer GGATTATTCATACCGTCCCA
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    IMPT-10314:GABBR2 was a gift from Vadim Cherezov & Raymond Stevens (Addgene plasmid # 157851 ; http://n2t.net/addgene:157851 ; RRID:Addgene_157851)
  • For your References section:

    Structural basis of the activation of a metabotropic GABA receptor. Shaye H, Ishchenko A, Lam JH, Han GW, Xue L, Rondard P, Pin JP, Katritch V, Gati C, Cherezov V. Nature. 2020 Jun 17. pii: 10.1038/s41586-020-2408-4. doi: 10.1038/s41586-020-2408-4. 10.1038/s41586-020-2408-4 PubMed 32555460