IMPT-10314:GABBR2
(Plasmid
#157851)
-
PurposeHA-3xFLAG-VFT-TMD-CC in pFastBac1 for Sf9 expression
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157851 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFastBac1
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 4776
- Total vector size (bp) 4776
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGABBR2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2475
-
Entrez GeneGABBR2 (a.k.a. DEE59, EIEE59, GABABR2, GPR51, GPRC3B, HG20, HRIHFB2099, NDPLHS)
- Promoter Polyhedrin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer GGATTATTCATACCGTCCCA
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
IMPT-10314:GABBR2 was a gift from Vadim Cherezov & Raymond Stevens (Addgene plasmid # 157851 ; http://n2t.net/addgene:157851 ; RRID:Addgene_157851) -
For your References section:
Structural basis of the activation of a metabotropic GABA receptor. Shaye H, Ishchenko A, Lam JH, Han GW, Xue L, Rondard P, Pin JP, Katritch V, Gati C, Cherezov V. Nature. 2020 Jun 17. pii: 10.1038/s41586-020-2408-4. doi: 10.1038/s41586-020-2408-4. 10.1038/s41586-020-2408-4 PubMed 32555460