Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDONOR223 R2pH-LAMP1-3xFLAG
(Plasmid #157941)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 157941 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDONOR223
  • Vector type
    GATEWAY system

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    R2pH-LAMP1-3xFLAG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2745
  • GenBank ID
    NM_001317353.1:229-1452
  • Entrez Gene
    Lamp1 (a.k.a. CD107a, LGP-120, LGP-A, Lamp-1, P2B, Perk)
  • Tags / Fusion Proteins
    • mCherry
    • pHluorin
    • 3XFLAG (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCGCGTTAACGCTAGCATGGAT
  • 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONOR223 R2pH-LAMP1-3xFLAG was a gift from Massimiliano Stagi (Addgene plasmid # 157941 ; http://n2t.net/addgene:157941 ; RRID:Addgene_157941)
  • For your References section:

    Live imaging of intra-lysosome pH in cell lines and primary neuronal culture using a novel genetically encoded biosensor. Ponsford AH, Ryan TA, Raimondi A, Cocucci E, Wycislo SA, Frohlich F, Swan LE, Stagi M. Autophagy. 2020 Jun 9:1-19. doi: 10.1080/15548627.2020.1771858. 10.1080/15548627.2020.1771858 PubMed 32515674