Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #158267)


Item Catalog # Description Quantity Price (USD)
Plasmid 158267 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    Pro-Code Tagged human dNGFR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    Truncation of the signaling domain
  • Entrez Gene
    NGFR (a.k.a. CD271, Gp80-LNGFR, TNFRSF16, p75(NTR), p75NTR)
  • Promoter EF1a
  • Tag / Fusion Protein
    • HSV.Ollas.S (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer cctttttgagtttggatcttggttcat
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO_HSV.Ollas.S_NGFR was a gift from Brian Brown (Addgene plasmid # 158267 ; ; RRID:Addgene_158267)
  • For your References section:

    Protein Barcodes Enable High-Dimensional Single-Cell CRISPR Screens. Wroblewska A, Dhainaut M, Ben-Zvi B, Rose SA, Park ES, Amir ED, Bektesevic A, Baccarini A, Merad M, Rahman AH, Brown BD. Cell. 2018 Nov 1;175(4):1141-1155.e16. doi: 10.1016/j.cell.2018.09.022. Epub 2018 Oct 18. 10.1016/j.cell.2018.09.022 PubMed 30343902