CMV-CitronRH
(Plasmid
#158545)
-
PurposeMammalian expression of nonbinding variant of direct-response citrate sensor
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158545 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCitronRH
-
Insert Size (bp)1100
- Promoter cmv
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains an A2V mutation in CitronRH. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-CitronRH was a gift from Robert Campbell (Addgene plasmid # 158545 ; http://n2t.net/addgene:158545 ; RRID:Addgene_158545) -
For your References section:
High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors for Citrate. Zhao Y, Shen Y, Wen Y, Campbell RE. ACS Cent Sci. 2020 Aug 26;6(8):1441-1450. doi: 10.1021/acscentsci.0c00518. Epub 2020 Jul 9. 10.1021/acscentsci.0c00518 PubMed 32875085