Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO.1 shSV40 neo
(Plasmid #158646)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158646 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1 neo
  • Backbone manufacturer
    Addgene #13425
  • Vector type
    Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SV40Tag
  • gRNA/shRNA sequence
    GCATAGAGTGTCTGCTATTAA
  • Species
    Simian virus 40
  • Entrez Gene
    SV40gp6 (a.k.a. SV40gp6)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 shSV40 neo was a gift from Kevin Janes (Addgene plasmid # 158646 ; http://n2t.net/addgene:158646 ; RRID:Addgene_158646)
  • For your References section:

    Modeling the complete kinetics of coxsackievirus B3 reveals human determinants of host-cell feedback. Lopacinski AB, Sweatt AJ, Smolko CM, Gray-Gaillard E, Borgman CA, Shah M, Janes KA. Cell Syst. 2021 Apr 21;12(4):304-323.e13. doi: 10.1016/j.cels.2021.02.004. Epub 2021 Mar 18. 10.1016/j.cels.2021.02.004 PubMed 33740397