pADsacA
(Plasmid
#158649)
-
PurposeConstitutive transcription of sacA crRNA and GFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158649 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAD123
- Backbone size w/o insert (bp) 5952
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology ; Shuttle vector Bacillus subtilis / E. coli
-
Selectable markersChloramphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsSelect for growth in Bacillus subtilis using Chloramphenicol.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesacA crRNA
-
Alt namehomologous arm of sacA
-
gRNA/shRNA sequenceAATTTCTACTGTTGTAGATTCGGCCGCCTCGATTATAACAAG
-
SpeciesFrancisella tularensis subsp. novicida
-
Insert Size (bp)1409
- Promoter Pveg
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gggttattgtctcatgagcgg
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains an E295G mutation in rep60. This mutation is not expected to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pADsacA was a gift from Wenjing Cui (Addgene plasmid # 158649 ; http://n2t.net/addgene:158649 ; RRID:Addgene_158649)