Skip to main content

pXPR_502_sgCD4
(Plasmid #158704)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158704 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pXPR
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD4
  • gRNA/shRNA sequence
    ATGTTCCCTGAGAGCCTGGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    CD4 (a.k.a. CD4mut, IMD79, Leu-3, OKT4D, T4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For questions regarding use of this plasmid, please contact John Doench.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_502_sgCD4 was a gift from John Doench & David Root (Addgene plasmid # 158704 ; http://n2t.net/addgene:158704 ; RRID:Addgene_158704)
  • For your References section:

    Identification of Antinorovirus Genes in Human Cells Using Genome-Wide CRISPR Activation Screening. Orchard RC, Sullender ME, Dunlap BF, Balce DR, Doench JG, Virgin HW. J Virol. 2018 Dec 10;93(1). pii: JVI.01324-18. doi: 10.1128/JVI.01324-18. Print 2019 Jan 1. 10.1128/JVI.01324-18 PubMed 30305350