Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pJV53-Cas12a
(Plasmid #158706)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158706 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJV53
  • Backbone manufacturer
    addgene 26904
  • Backbone size w/o insert (bp) 8919
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FnCpf1
  • Species
    Francisella tularensis subsp. Novicida
  • Insert Size (bp)
    3903
  • Promoter TetO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer ACTAGTGGCCATGATGGCAT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJV53-Cas12a was a gift from Yi-Cheng Sun (Addgene plasmid # 158706 ; http://n2t.net/addgene:158706 ; RRID:Addgene_158706)
  • For your References section:

    CRISPR-Cas12a-Assisted Recombineering in Bacteria. Yan MY, Yan HQ, Ren GX, Zhao JP, Guo XP, Sun YC. Appl Environ Microbiol. 2017 Aug 17;83(17). pii: AEM.00947-17. doi: 10.1128/AEM.00947-17. Print 2017 Sep 1. 10.1128/AEM.00947-17 PubMed 28646112