Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCR-Hyg
(Plasmid #158708)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158708 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSL001
  • Backbone manufacturer
    from Houhui Song's Lab
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology ; Mycobacteria Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    crRNA
  • gRNA/shRNA sequence
    gtctaagaactttaaataatttctactgttgtagattccgtctccggcctccagtagtattcggcgaagcttgtctaagaactttaaataatttctactgttgtagat
  • Species
    Other
  • Promoter Hsp60

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that several differences were identified in the plasmid backbone compared to the depositor's sequence. These differences do not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCR-Hyg was a gift from Yi-Cheng Sun (Addgene plasmid # 158708 ; http://n2t.net/addgene:158708 ; RRID:Addgene_158708)
  • For your References section:

    CRISPR-Cas12a-Assisted Recombineering in Bacteria. Yan MY, Yan HQ, Ren GX, Zhao JP, Guo XP, Sun YC. Appl Environ Microbiol. 2017 Aug 17;83(17). pii: AEM.00947-17. doi: 10.1128/AEM.00947-17. Print 2017 Sep 1. 10.1128/AEM.00947-17 PubMed 28646112