Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #158758)


Item Catalog # Description Quantity Price (USD)
Plasmid 158758 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Species
  • Insert Size (bp)
  • Promoter synapsin promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCGACCATCTGCGCTGC
  • 3′ sequencing primer GGCATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Syn-nullCoChR-GCaMP6f-Kv2.1 was a gift from Edward Boyden (Addgene plasmid # 158758 ; ; RRID:Addgene_158758)
  • For your References section:

    Precision Calcium Imaging of Dense Neural Populations via a Cell-Body-Targeted Calcium Indicator. Shemesh OA, Linghu C, Piatkevich KD, Goodwin D, Celiker OT, Gritton HJ, Romano MF, Gao R, Yu CJ, Tseng HA, Bensussen S, Narayan S, Yang CT, Freifeld L, Siciliano CA, Gupta I, Wang J, Pak N, Yoon YG, Ullmann JFP, Guner-Ataman B, Noamany H, Sheinkopf ZR, Park WM, Asano S, Keating AE, Trimmer JS, Reimer J, Tolias AS, Bear MF, Tye KM, Han X, Ahrens MB, Boyden ES. Neuron. 2020 Jun 26. pii: S0896-6273(20)30398-6. doi: 10.1016/j.neuron.2020.05.029. 10.1016/j.neuron.2020.05.029 PubMed 32592656