Skip to main content

elavl3:SomaGCaMP7f
(Plasmid #158760)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158760 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PZ0
  • Backbone size w/o insert (bp) 12509
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SomaGCaMP7
  • Alt name
    GCaMP7F
  • Alt name
    GCaMP7
  • Species
    Synthetic
  • Insert Size (bp)
    1710
  • Promoter HuC promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tatccctctcagacgcattg
  • 3′ sequencing primer TCCAAACTCATCAATGTATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    elavl3:SomaGCaMP7f was a gift from Edward Boyden (Addgene plasmid # 158760 ; http://n2t.net/addgene:158760 ; RRID:Addgene_158760)
  • For your References section:

    Precision Calcium Imaging of Dense Neural Populations via a Cell-Body-Targeted Calcium Indicator. Shemesh OA, Linghu C, Piatkevich KD, Goodwin D, Celiker OT, Gritton HJ, Romano MF, Gao R, Yu CJ, Tseng HA, Bensussen S, Narayan S, Yang CT, Freifeld L, Siciliano CA, Gupta I, Wang J, Pak N, Yoon YG, Ullmann JFP, Guner-Ataman B, Noamany H, Sheinkopf ZR, Park WM, Asano S, Keating AE, Trimmer JS, Reimer J, Tolias AS, Bear MF, Tye KM, Han X, Ahrens MB, Boyden ES. Neuron. 2020 Jun 26. pii: S0896-6273(20)30398-6. doi: 10.1016/j.neuron.2020.05.029. 10.1016/j.neuron.2020.05.029 PubMed 32592656