Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBOB-CAG-SARS-CoV2-Spike D614G-HA
(Plasmid #158761)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158761 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBOB-CAG
  • Backbone manufacturer
    Verma Lab (Salk Institute)
  • Backbone size w/o insert (bp) 9606
  • Total vector size (bp) 13467
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    do not overgrow
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV2 Spike Glycoprotein
  • Alt name
    Spike glycoprotein
  • Alt name
    Spike
  • Alt name
    S
  • Species
    SARS-CoV2 hCoV19_USA EPI_ISL_414366 (GISAID)
  • Insert Size (bp)
    3861
  • Mutation
    Spike D614G
  • GenBank ID
    CAD0240757.1
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter CAG
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAG-FWD AGCCTCTGCTAACCATGTTC
  • 3′ sequencing primer WPRE-REV TCCTCCTCCTCTTGTGCTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBOB-CAG-SARS-CoV2-Spike D614G-HA was a gift from Gerald Pao (Addgene plasmid # 158761 ; http://n2t.net/addgene:158761 ; RRID:Addgene_158761)
  • For your References section:

    The D614G mutation in the SARS-CoV2 Spike protein increases infectivity in an ACE2 receptor dependent manner. Ogawa J, Zhu W, Tonnu N, Singer O, Hunter T, Ryan AL, Pao GM. bioRxiv. 2020 Jul 22. doi: 10.1101/2020.07.21.214932. 10.1101/2020.07.21.214932 PubMed 32743569