ACE2
(Plasmid #164219)

• Purpose: Expresses full length human ACE2 protein, along with TagBFP reporter and Puromycin selection marker
• Depositing Lab: Sriram Neelamegham
• Publication: Yang et al Elife. 2020 Oct 26;9. pii: 61552. doi: 10.7554/eLife.61552.

Backbone

• Vector backbone: pKLV2
• Backbone manufacturer: Addgene plasmid 67974
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ACE2
• Species: H. sapiens (human)
• Insert Size (bp): 2415
• Mutation: silent mutation to remove internal EcoRI site (GAATTC to AAATTC)
• Entrez Gene: ACE2 (a.k.a. ACEH)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: AGCAAATGAGCAGGGAGGCATC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene plasmids 1786 and 67974
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry